Advertisement

Digenic Inheritance of a FOXC2 Mutation and Two PIEZO1 Mutations Underlies Congenital Lymphedema in a Multigeneration Family

Published:October 14, 2021DOI:https://doi.org/10.1016/j.amjmed.2021.09.007

      Abstract

      Background

      The lymphatic system is essential for maintaining the balance of interstitial fluid in tissues and for returning protein-rich fluids (lymph) to the bloodstream. Congenital lymphatic defects lead to accumulation of lymph in peripheral tissues and body cavities, termed primary lymphedema. To date, only a limited number of individual genes have been identified in association with primary lymphedema. However, variability of age of onset and severity of lymphatic abnormalities within some families suggests that multiple mutations or genes may be responsible, thus hampering efforts to identify individual associated genes.

      Methods

      Whole exome sequencing (WES) was performed in 4 members of a large multigeneration family with highly variable lymphedema and followed by Sanger sequencing for identified mutations in 34 additional family members. Genotypes were correlated with clinical and lymphangioscintigraphic phenotypes.

      Results

      WES uncovered 2 different mechanotransducer PIEZO1 mutations and one FOXC2 transcription factor mutation in various combinations. Sanger sequencing confirmed the presence/absence of the 3 variants in affected and unaffected family members and co-segregation of one or more variants with disease. Genetic profiles did not clearly correlate with the highly variable severity of lymphatic abnormalities.

      Conclusions

      WES in lymphedema families can uncover unexpected combinations of several lymphedema-associated mutations. These findings provide essential information for genetic counseling and reveal complex gene interactions in lymphatic developmental pathways. These can offer insights into the complex spectrum of clinical and lymphatic lymphedema phenotypes and potential targets for treatment.

      Keywords

      Clinical Significance
      • This is the first report of oligogenic inheritance of known lymphedema-causing genes in a large multigeneration family studied by whole exome and Sanger sequencing.
      • Broad spectrum of clinical severity and lymphangiodysplastic phenotypes was documented by non-invasive lymphangioscintigraphy and non-contrast magnetic resonance imaging.
      • Pathogenic variants of transcription factor FOXC2 and 2 alleles of PIEZO1 were found in different combinations, with FOXC2 known to govern lymphatic endothelial expression of mechanotransducer PIEZO1.

      Introduction

      The lymphatic system is composed of a network of lymphatic capillaries that drain into collecting lymphatic vessels and bring protein-rich fluid (lymph) back to the blood circulation. It is essential for maintaining fluid homeostasis and transport of immune cells, inflammatory molecules, and dietary lipids. Congenital defects in the lymphatic system result in the accumulation of lymph (lymphedema) in peripheral tissues, most commonly in the limbs, but may occur more generally as in generalized lymphatic dysplasia. Primary lymphedema often demonstrates considerable variance in symptom onset and severity, even within a family, thereby confounding earlier efforts to identify a single associated familial gene variant and suggesting that multiple variants may be responsible for some, if not most, familial lymphedemas. With expanded availability of whole exome sequencing (WES), researchers are now able to expeditiously determine the presence of multiple gene variants within a single lymphedema family. Most importantly, the ability to identify variant combinations within individuals and associate them with particular clinical and lymphatic phenotypes may provide insight for improved individualized treatment modalities.
      In 1998, we used whole-body lymphangioscintigraphy to describe a wide range of lymphangiodysplastic phenotypes in 5 families.
      • Witte MH
      • Erickson R
      • Bernas M
      • et al.
      Phenotypic and genotypic heterogeneity in familial Milroy lymphedema.
      However, classic linkage studies, that is, a genome-wide search using 387 polymorphic dinucleotide repeat markers, failed to identify any putative lymphedema linkages.
      • Holberg CJ
      • Erickson RP
      • Bernas MJ
      • et al.
      Segregation analyses and a genome-wide linkage search confirm genetic heterogeneity and suggest oligogenic inheritance in some Milroy congenital primary lymphedema families.
      Herein we present whole exome and Sanger sequencing data, as well as expanded clinical and updated lymphatic phenotype data, for 38 members of the largest of the 5 families, Family 4, identifying 2 unpublished variants in the mechanically activated ion channel, PIEZO1, and one previously published FOXC2 mutation that co-segregate with disease. Furthermore, lymphedema occurs only in those Family 4 members that carry specific combinations of these variants.

      Materials and Methods

      Informed consent was obtained from all subjects according to a protocol approved by the University of Arizona Institutional Review Board.

      DNA Sequencing

      Whole exome sequencing (WES)

      WES was performed, as detailed in Erickson et al
      • Erickson RP
      • Lai LW
      • Mustacich DJ
      • Bernas MJ
      • Kuo PH
      • Witte MH
      Sex-limited penetrance of lymphedema to females with CELSR1 haploinsufficiency: a second family.
      and Lai et al
      • Lai LW
      • Erickson RP
      • Bernas M
      • Witte MH
      From childhood onset lymphedema to fatal fetal hydrops: possible modifying genes for a FOXC2 mutation.
      , and in the Supplementary Material (available online), using the SeqCap EZHuman Exome Library v3.0 (Roche NimbleGen Inc., Pleasonton, Calif), followed by 2 × 100 bp paired-end sequencing on the Illumina HiSeq 2500 (Illumina Inc., San Diego, Calif). Sequences were aligned to the human genome (GRCh37) and analysis performed using Genome Analysis Toolkit, v.3.3-0. Variant call format files were uploaded to Ingenuity Variant Analysis (version 5.1.20171220; Qiagen, Redwood City, Calif). Filter settings are listed in the Supplementary Material. Disease association of the variants was computed according to the American College of Medical Genetics and Genomics (ACMG) variant classification guidance, establishment in the literature, and the predicted activity of the variant by Ingenuity (Table S1).

      Sanger sequencing

      Genomic DNA was extracted from blood (QIAamp DNA blood minikit; Qiagen, Germantown, Md). The region surrounding each of the 3 variants was amplified by polymerase chain reaction. See Table S2 (available online) for primers. Presence/absence of variants was confirmed by Sanger sequencing (Eton Bioscience, San Diego, Calif) and analysis with SnapGene software (GSL Biotech, Chicago, Ill). Pedigree and exemplative Sanger sequences are shown in Fig. 1 and Fig. S1, S2 and S3 (available online), respectively.
      Figure 1
      Figure 1Six-generation Family 4 pedigree showing lymphedema affected and unaffected family members and presence of PIEZO1 or FOXC2 mutations.

      Lymphatic imaging

      Bipedal lymphangioscintigraphy was performed as previously described.
      • Erickson RP
      • Lai LW
      • Mustacich DJ
      • Bernas MJ
      • Kuo PH
      • Witte MH
      Sex-limited penetrance of lymphedema to females with CELSR1 haploinsufficiency: a second family.
      Briefly, approximately 500 µCi of filtered Technetium-99m albumin or sulfur colloid was injected intradermally into the toe web spaces of both feet (total of 1 mCi) or hands. Immediate dynamic images were obtained in the lower and upper extremities over 15 minutes, and delayed images of the lower (upper) extremities, abdomen, and chest obtained serially thereafter up to 4 hours. Magnetic resonance imaging without contrast of the central lymphatic channels was performed on a Siemens 3T scanner (Siemens Medical Solutions USA Inc., Malvern, Pa) using a low-flow protocol as described previously.
      • Seckeler MD
      • Moedano L
      • Mustacich D
      • et al.
      Non-contrast MR lymphography of rare lymphatic abnormalities.

      Results

      Mutational Studies

      Whole exome sequencing (WES)

      Genomic DNA from affected and unaffected family members was used for WES. Variant calling was performed according to ACMG variant classification guidance, as described in the Supplementary Material (available online) and previously, in Lai et al, 2018.
      • Lai LW
      • Erickson RP
      • Bernas M
      • Witte MH
      From childhood onset lymphedema to fatal fetal hydrops: possible modifying genes for a FOXC2 mutation.
      We identified 2 unpublished variants in the PIEZ01 gene, a recently identified pathogenic gene for autosomal recessive hereditary lymphedema: a missense variant c.7316G>A (p.Gly2439Asp), and a nonsense variant, c.3373C>T (p.Gln1125Ter). In addition, we identified a previously reported missense variant c.1331A>G (p Gln444Arg) in FOXC2.
      • Van Steensil MAM
      • Damstra RJ
      • Heitnk MV
      • et al.
      Novel missense mutations in the FOXC2 gene alter transcriptional activity.

      Sanger sequencing

      Sanger sequencing for each of the 3 variants was undertaken for 38 family members (inadequate for one) and confirmed segregation of the compound heterozygous PIEZO1 p.Gly2439Asp/p.Gln1125Ter genotype, the homozygous PIEZO1 p.Gly2439Asp variant, and the FOXC2 variant with disease status (Table).
      TableClinical Findings and Sanger Sequencing Results for Affected and Unaffected Family Members
      Sanger Sequencing
      Pedigree #WESLELASOtherPIEZO1 c.3373C>TPIEZO1 c.7316G>AFOXC2 c.1331A>G
      III-12NNNo MutNo MutNo Mut
      III-14NNNo MutNo MutNo Mut
      IV-4NNHetZ MutNo MutNo Mut
      IV-5YYNGNo MutHetZ MutHetZ Mut
      IV-6NNHetZ MutNo MutNo Mut
      IV-17NNNo MutNo MutNo Mut
      IV-18NNNo MutNo MutNo Mut
      IV-19NNNo MutNo MutNo Mut
      IV-21NNNo MutHetZ MutNo Mut
      IV-22NNHetZ MutNo MutNo Mut
      V-1NNNo MutHetZ MutNo Mut
      V-2YYVVHetZ MutHetZ MutNo Mut
      V-3YYG, H, J, RHetZ MutHetZ MutNo Mut
      V-4YYYG, H, J, RDW↑, VVHetZ MutHetZ MutHetZ Mut
      V-5YYGHetZ MutHetZ MutHetZ Mut
      V-6NNnoJHetZ MutNo MutHetZ Mut
      V-7NNNo MutNo MutNo Mut
      V-8YNH, JHetZ MutHetZ MutNo Mut
      V-9YYG, VVHetZ MutHetZ MutNo Mut
      V-11NNNo MutNo MutNo Mut
      V-12NNHM, noJ/HHetZ MutNo MutHetZ Mut
      V-13YNCoat's Syn, noJNo MutNo MutHetZ Mut
      V-15NNNo MutNo MutNo Mut
      V-16NNNo MutNo MutNo Mut
      V-17YYNHetZ MutHetZ MutNo Mut
      V-18YNCHD, Down SynNo MutNo MutNo Mut
      V-21NNNo MutHetZ MutNo Mut
      V-22YYYG, H, J, RDW↑No MutHomoZ MutNo Mut
      V-23YNH, JNo MutHomoZ MutNo Mut
      V-31NNNo MutHetZ MutNo Mut
      V-32NNHetZ MutNo MutNo Mut
      V-34NNNo MutNo MutNo Mut
      V-36NNNo MutNo MutNo Mut
      V-37YYG, H, RDW↑HetZ MutHetZ MutNo Mut
      V-38NNNo MutNo MutNo Mut
      VI-3NNNo MutNo MutQ
      VI-6YYG, HF, ChylR, RDW↑QQQ
      VI-7NNNo MutNo MutNo Mut
      c.3373C>T = nonsense mutation; c.7316G>A = missense mutation; c.1331A>G = missense mutation.
      CHD = congenital heart disease; ChylR = Chylous reflux; G = generalized LE; H = Hematuria; HetZ = heterozygous; HF = hydrops fetalis; HM = Heart murmur; HomoZ = homozygous; J = Jaundice; LAS = Lymphangioscintigram; LE = Lymphedema; Mut = mutation; N = No; Q = Inadequate sample; R = renal disease; RDW↑ = red cell distribution width (increased); Syn = syndrome; VV = varicose veins; WES = whole exome sequencing; Y = Yes.
      Family segregation studies revealed that both homozygous PIEZO1 p.Gly2439Asp and compound heterozygous PIEZO1 p.Gly2439Asp/p.Gln1125Ter variants were present in affected family members but not in unaffected members (Table and Fig. 1). Interestingly, the FOXC2 p.Gln444Arg variant (Supplementary Table 1, available online) was found in combination with the compound heterozygous PIEZO1 p.Gly2439Asp/p.Gln1125Ter variants in the severely affected V-4 and V-5 brothers. Their less severely affected mother (IV-5) carried the heterozygous PIEZO1 p.Gly2439Asp and heterozygous FOXC2 p.Gln444Arg variants, but did not carry the PIEZO1 p.Gln1125Ter variant. Two unaffected family members (Fig. 1, V-6 and V-12) carried both the heterozygous FOXC2 p.Gln444Arg variant and the PIEZO1 p.Gln1125Ter variant. Several unaffected family members carried single copies of one or the other of the PIEZO1 variants (Fig. 1 and Table). Although only 4 of the 6 mutation severity prediction programs predict the FOXC2 mutation as “likely to be pathogenic,” this mutation has previously been found to be associated with congenital lymphedema (patient 6).
      • Van Steensil MAM
      • Damstra RJ
      • Heitnk MV
      • et al.
      Novel missense mutations in the FOXC2 gene alter transcriptional activity.
      Table S1PIEZO1 Pathogenic Variants and FOXC2 Variant Identified in Family 4
      PositionBandVariationGene RegionGene SymbolTranscript IDTranscript VariantProtein VariantIAHGF (max) %GF (Euro) %TIdbSNP IDVC
      16:86602272q24.1SNVExonicFOXC2NM_005251.2c.1331A>Gp.Q444RgainDG0.1080.164mis147258453LP
      16:88782341q24.3SNVExonicPIEZO1NM_001142864.3c.7316G>Ap.G2439DlossDG, AR00misLP
      16:88793529q24.3SNVExonicPIEZO1NM_001142864.3c.3373C>Tp.Q1125*lossAR00fsP
      Variants were filtered as described (30) and associated with disease status. AR = Autosomal Recessive; DG = Digenic Inheritance; fs = frame shift; GF (Euro) = gnomAD European Frequency; H = Inheritance; HGF (max) = Allele frequencies for population with the highest allele frequency across all gnomAD populations; IA = Inferred Activity; LP = likely pathogenic; mis = missense; syn = synonymous; TI = Translation Impact; Variants Classification = VC; VUS = variant of unknown significance. Human genome reference assembly version GRCh37/hg19 was used in this study.
      Table S2Primers Used for PCR and Sanger Sequencing of the PIEZO1 and FOXC2 Variants. *Primers used only for sequencing.
      Primer NamePrimer Sequence 5′–3′
      P3373 Forward AGGGTGGGAGGTGGGATTTATG
      P3373 Reverse AGGATAAAGTTGGGCACGGGG
      P3373 Forward BGGGTGGGAGGTGGGATTTATG
      P3373 Reverse BTATCGGACAGCCAGAACAGG
      P7316 Forward AAATGGTGGGTCATCGAGCTG
      P7316 Reverse ACGGCAGCTCCTCGAACATAA
      P7316 Forward BTCGAATGGTGGGTCATCGAG
      P7316 Reverse BGATGTCCTGGCAGAGCTTGA
      P7316 Forward CCCAGATGAGGAGGCCGACTA
      P7316 Reverse CAACTTGCCGATGACCAGCAC
      P7316 Forward DCGAATGGTGGGTCATCGAGC
      P7316 Reverse DGATCTCGCTGAAGAATCCGC
      FOXC2 Forward ACTGGACGAGGCCCTCTCGGACC
      FOXC2 Reverse AGGAGGTCCCGGGACACGTCA
      Note that affected family members with lymphedema exhibited all possible combinations of FOXC2 and PIEZO1 alleles except for homozygous nonsense mutations (probably lethal) and FOXC2 homozygous, which is lethal (Table). Thus, FOXC2 ± alone, FOXC2 ± with one or another heterozygous PIEZO1 mutations, and homozygous PIEZO1 missense mutations were all found. Lymphangioscintigraphy (see below) did not clearly distinguish the genotypes and generally conformed to a hyperplastic refluxing phenotype (less common compared with typical Milroy lymphedema aplasia/hypoplasia), as previously documented in FOXC2 haploinsufficient lymphedema-distichiasis.
      • Kinmonth J
      Primary lymphoedema.
      ,
      • Sarica M
      • Gordon K
      • van Zanten M
      • et al.
      Lymphoscintigraphic abnormalities associated with Milroy disease and lymphedema-distichiasis syndrome.

      Clinical Findings

      General

      Lymphedema of the lower limbs almost always appeared at birth with swelling of the upper limbs and face occurring in some individuals.
      • Witte MH
      • Erickson R
      • Bernas M
      • et al.
      Phenotypic and genotypic heterogeneity in familial Milroy lymphedema.
      Genital lymphedema was less common. The lymphangioscintigrams presented in the earlier report may be briefly summarized as showing irregular dilated channels, dermal backflow, and reflux. Additional, more recent, lymphangioscintigrams are included in composite Fig. 2 and 3 for comparison and reinterpretation, considering evolution of this imaging technique and patterns that have emerged in hereditary lymphedema in the intervening time interval.
      • Erickson RP
      • Lai LW
      • Mustacich DJ
      • Bernas MJ
      • Kuo PH
      • Witte MH
      Sex-limited penetrance of lymphedema to females with CELSR1 haploinsufficiency: a second family.
      Doppler venograms showed venous reflux in the patients with prominent venous varicosities, confirming associated venous valve involvement. Thus, the familial congenital lymphedema can be summarized as a hyperplastic, refluxing condition of the lymphatics, reflecting lymphatic valve incompetence (possibly, at least in some instances [Fig. 3E], related to more proximal central lymphatic obstruction)
      • Witte MH
      Lymphangioleiomyomatosis and Gorham-Stout disease: primary or secondary disorders of the lymphatic system?.
      and concomitant venous varicosities with insufficiency reflecting venous valve incompetence.
      Figure 2
      Figure 2Lymphangioscintigrams (LAS) in multiple family members with varied digenic FOXC2-PIEZO1 and homozygous/heterozygous PIEZO1 allele recessive genotypes (Roman numerals correspond to position in pedigree, ). LAS of affected family members demonstrate a spectrum of mild to severe abnormalities, but with a similar pattern of lymphatic refluxing hyperplasia rather than lymphatic hypoplasia. Repeated findings include lymphatic valvular incompetence with reflux, obstructed lymphatic channels in lower legs, and occasionally reflux into genitalia. LAS of upper extremities show a hyperplastic obstructive phenotype without regional lymph node visualization, suggesting more central lymphatic dysplasia and obstruction, although tracer eventually enters the blood circulation as demonstrated by hepatic uptake. (A) LAS of a normal subject for comparison. Top: Upper extremities and torso after radiotracer injections in the hands demonstrate normal appearance of lymphatic channels and regional lymph nodes draining the arms. Bottom: Lower extremities and pelvis/retroperitoneum/abdomen after injection of the feet demonstrate normal appearance of lymphatic vessels and regional lymph nodes draining the legs, pelvis, retroperitoneum, and abdomen. No tracer reflux is noted. Normal uptake is seen in the liver and kidneys. (B) LAS in family member V-22 (homozygous missense PIEZO1) after injection of the feet shows hyperplastic lymphatic vessels and multiple, tortuous vessels as well as normal uptake in the liver. (C) LAS in V-2 (compound heterozygous missense and nonsense PIEZO1) shows distal lymphatic hyperplasia, dermal tracer reflux, and delayed transport. (D) Early LAS (left) in V-3 (compound heterozygous missense and nonsense PIEZO1) shows similar obstructive pattern in the right leg, with distal hyperplasia and dermal reflux and a more hyperplastic pattern with valvular incompetence and dermal reflux in the left leg. Delayed (∼4 hours later) LAS (right) shows gradual clearing of tracer from the legs and extensive scrotal tracer reflux, suggesting deep lymphatic rerouting and increased pelvic nodal activity. (E) Early LAS (left) in V-5 (heterozygous FOXC2 and compound heterozygous missense and nonsense PIEZO1) and delayed image (at ∼4 hours; right) show delayed tracer transport in the left leg with lymphatic hyperplasia and dermal reflux in the right leg and progressive filling of popliteal node (signifying deep rerouting related to proximal obstruction), tracer reflux into the scrotum, and abnormally increased activity in lower abdomen. (F) LAS in V-9 (compound heterozygous missense and nonsense PIEZO1) shows lymphatic hyperplasia with extensive dermal reflux in both legs and tracer dispersion in the abdomen and mediastinum, suggesting central lymphatic dysplasia and obstruction; (G) LAS of lower and upper extremities in V-37 (compound heterozygous missense and nonsense PIEZO1) demonstrates lymphatic hyperplasia, particularly prominent in the upper extremities, and valvular incompetence with dermal reflux. Panels C-F reproduced with permission of Lymphology,
      • Witte MH
      • Erickson R
      • Bernas M
      • et al.
      Phenotypic and genotypic heterogeneity in familial Milroy lymphedema.
      but with current image reinterpretation and genotypic characterization added. See text and the for further details.
      Figure 3
      Figure 3Clinical and lymphatic imaging phenotypes of 2 additional severely affected family members. Images A-E are from family member V-4 with whole exome sequencing and Sanger-documented compound heterozygous FOXC2 and PIEZO1 heterozygous recessive missense and nonsense mutations. Images in F-H are from a distant family member with presumptive PIEZO1 heterozygous missense and nonsense recessive (based on parental genotypes and 3 normal sisters), who initially presented with fetal hydrops at another hospital. In V-4, lymphangioscintigram (LAS) (A) compared with (B) shows progression from severe to complete lymphatic obstruction on lower-extremity LAS over a 6-year period, with obliteration of hyperplastic lymphatics and resulting image resembling congenital lymphatic aplasia, but with persistence of hyperplastic obstructed lymphatics in the upper extremities, with prominent activity at valves and lack of nodal uptake still in evidence of the original hyperplastic pattern. Photographs demonstrate progression from (C) severe lymphedema to (D) elephantiasis over a similar time period to the LAS in (A) and (B). Panel E shows magnetic resonance imaging of the chest without contrast, with vestigial thoracic duct (arrow) and multiple dilated and tortuous lymphatic collecting channels bilaterally in the chest documenting central lymphatic obstruction. F-H LAS in extended family member VI-6, who presented with fetal hydrops shortly after birth, demonstrated on LAS (F) after hand and foot injections generalized lymphatic dysplasia without any distinct lymphatic channels, but rather extensive diffusion of tracer into subcutaneous tissues and body cavities. (G) Two years later, patient had marked regression of generalized lymphedema, as demonstrated by minimal periorbital edema and mild lymphedema of distal lower extremities. (H) Consistent with the improved clinical presentation, LAS after single left foot injection showed persistent marked dermal diffusion but new visualization of discrete dilated channels in the upper leg extending into the retroperitoneum. Retrograde reflux into contralateral right pelvic channels is noted (arrow), likely indicating persistent central lymphatic obstruction. See text and the for further details.
      Figure S1
      Figure S1Sanger sequencing chromatograms of (A) PIEZO1 c.3373C>T, Normal (V-31); (B) PIEZO1 c.3373C>T, Heterozygous (IV-4)
      Figure S2
      Figure S2Sanger sequencing chromatograms of (A) PIEZO1 c.7316G>A, Normal (V-32); (B) PIEZO1 c.7316G>A, Heterozygous (IV-21); (C) PIEZO1 c.7316G>A, Homozygous (IV-23)
      Figure S3
      Figure S3Sanger sequencing chromatograms of (A) FOXC2 c.1331A>G, Normal (V-1); (B) FOXC2 c.1331A>G, Heterozygous (V-6)

      Other syndromic features

      Several family members (with PIEZO1 mutations) exhibited intermittent painless jaundice that had been diagnosed as Gilbert disease, clinically. However, on our WES, they did not have mutations in uridine 5′-diphospho-glucuronyltransferase, the gene involved in Gilbert disease.
      • Arias IM
      • Gartner LM
      • Cohen M
      • Ben-Ezzer J
      • Levi AJ
      Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronyl transferase deficiency: clinical, biochemical, pharmacologic and genetic evidence for heterogeneity.
      Several of these individuals (where it had been recorded) showed widened red cell width, anisocytosis, and dark urine intermittently associated with jaundice, consistent with intermittent hemolytic episodes related to stomacytosis, although this red blood cell abnormality was not specifically examined and had not yet been described in PIEZO1-recessive lymphatic dysplasia families. In addition, one individual who exhibited lymphedema did not have the described mutations in PIEZO1 or FOXC2, but had Down syndrome (trisomy 21), a known cause of lymphedema and even fetal hydrops.
      • Greenlee R
      • Hoyme H
      • Witte M
      • Crowe CP
      • Witte C
      Developmental disorders of the lymphatic system.

      Discussion

      Classic linkage studies in 5 families with 387 genetic markers, one of which was closely linked to FLT4, found weak indications of linkage to several chromosomal regions.
      • Holberg CJ
      • Erickson RP
      • Bernas MJ
      • et al.
      Segregation analyses and a genome-wide linkage search confirm genetic heterogeneity and suggest oligogenic inheritance in some Milroy congenital primary lymphedema families.
      However, the reason for the failure to identify a single chromosomal region in our linkage study became apparent as multiple genes were identified as causal in family lymphedema, especially FLT4 (the VEGFCreceptor
      • Karkkainen MJ
      • Ferrell RE
      • Lawrence EC
      • et al.
      Missense mutations interfere with VEGFR-3 signalling in primary lymphoedema.
      and FOXC2).
      • Fang JM
      • Dagenais SL
      • Erickson RP
      • et al.
      Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome.
      Thus, although one of our markers had been very near to FLT4, the heterogeneity of the families and the fact that mutations in this gene were only found later in one of the smaller families, prevented detection of this linkage. Family 4, one of several presented, was unusual for the range of severity encountered, which, at the time, found its most extreme expression in individual V-4 (see Clinical Findings Fig. 3, and Witte et al
      • Witte MH
      • Erickson R
      • Bernas M
      • et al.
      Phenotypic and genotypic heterogeneity in familial Milroy lymphedema.
      ). On sequencing, the family was found to segregate for 2 PIEZO1 mutations (1 nonsense and 1 missense) and a FOXC2 missense mutation, with all 3 mutations found in individuals V-4 and V-5.
      The segregation study using WES and Sanger sequencing in this large consanguineous family demonstrates that all affected family members fit into one of 5 inheritance patterns: 1) digenic inheritance of heterozygous FOXC2 missense mutation and heterozygous PIEZO1 mutation; 2) homozygous for the PIEZO1 missense mutation; 3) compound heterozygous for a PIEZO1 missense mutation and the PIEZO1 nonsense mutation, including one presumed based on parental PIEZO1 genotypes and 3 normal sisters without lymphedema (a thoracic duct abnormality was also documented in this group); 4) combination of 1) and 3) that presented a more severe form of disease; and 5) heterozygous for the FOXC2 mutation alone, one individual with no history of lymphedema (but most mutations in FOXC2 are late onset and mild). Incompetent varicose veins were identified in some compound heterozygous PIEZO1 individuals (V-2, V-4, V-9), whether or not they were heterozygous for the FOXC2 mutation.
      Unaffected family members have none of these pathogenic variants or are heterozygous for a single PIEZO1 variant, thus functioning as carriers of the recessive mutations. Patient V-4 had an unusually severe congenital lymphedema phenotype. He was not only compound heterozygous for the 2 PIEZO1 mutations segregating in the family, but also inherited a FOXC2 mutation. This mutation had previously been found in a patient with varicose veins, aortic stenosis, and lymphedema, with onset at age 6 years.
      • Van Steensil MAM
      • Damstra RJ
      • Heitnk MV
      • et al.
      Novel missense mutations in the FOXC2 gene alter transcriptional activity.
      The mutation was a gain-of-function mutation, as shown by increased activity in a luciferase, transactivation recorder system.
      • Van Steensil MAM
      • Damstra RJ
      • Heitnk MV
      • et al.
      Novel missense mutations in the FOXC2 gene alter transcriptional activity.
      The mutation was also reported in 1 of 93 patients with tetralogy of Fallot.
      • Topf A
      • Griffin HR
      • Glen E
      • et al.
      Functionally significant, rare transcription factor variants in tetralogy of Fallot.
      Thus, as shown in mice,
      • Noon A
      • Hunter RJ
      • Witte MH
      • et al.
      Comparative lymphatic, ocular, and metabolic phenotypes of FOXC2 haploinsufficient and AP2-FOXC2 Transgenic mice.
      in patients,
      • Tavian D
      • Missaglia S
      • Maltese PE
      • et al.
      FOXC2 disease-mutations identified in lymphedema-distichiasis patients cause both loss and gain of protein function.
      and in a patient with a FOXC2 duplication,
      • Witte MH
      • Erickson RP
      • Khalil M
      • et al.
      Lymphedema-distichiasis syndrome without FOXC2 mutation: evidence for Chromosome 16 duplication upstream of FOXC2.
      overexpression as well as underexpression of FOXC2 can lead to generalized lymphatic abnormalities.
      Mechanosensors, such as PIEZO1, play a vital role in the development, maintenance, and function of the vasculature, including the intraluminal valves that maintain forward lymph flow. Both lymphatic valve formation and maintenance are regulated by oscillatory fluid flow via mechanosensors.
      • Ge J
      • Li W
      • Zhao Q
      • et al.
      Architecture of the mammalian mechanosensitive Piezo1 channel.
      ,
      • Geng X
      • Cha B
      • Mahamud MR
      • et al.
      Multiple models of primary lymphedema exhibit distinct defects in lymphovenous valve development.
      Importantly, PIEZO1 knockdown prevents oscillatory shear stress-induced upregulation of lymphatic valve-associated genes, that is, FOXC2 and GATA2.
      • Choi D
      • Park E
      • Jung E
      • et al.
      Piezo1 incorporates mechanical force signals into the genetic program that governs lymphatic valve development and maintenance.
      Conditional deletion of PIEZO1 in lymphatic endothelial cells in day 1 postnatal pups leads to failed lymphatic valve development and decreased lymphatic vessel density at day 7.
      • Choi D
      • Park E
      • Jung E
      • et al.
      Piezo1 incorporates mechanical force signals into the genetic program that governs lymphatic valve development and maintenance.
      In addition, conditional lymphatic PIEZO1 deletion (day 21) caused significant degeneration of lymphatic valves and vessels in skin and mesentery (day 49), indicating that PIEZO1 is not only essential for lymphatic valve development, but also required for lymphatic valve maintenance in adults.
      • Choi D
      • Park E
      • Jung E
      • et al.
      Piezo1 incorporates mechanical force signals into the genetic program that governs lymphatic valve development and maintenance.
      ,
      • Nonomura K
      • Lukacs V
      • Sweet DTM
      • et al.
      Mechanically activated ion channel PIEZO1 is required for lymphatic valve formation.
      Others have reported that the oscillatory shear stress-induced upregulation of FOXC2 gene via GATA2
      • Sweet DT
      • Jiménez JM
      • Chang J
      • et al.
      Lymph flow regulates collecting lymphatic vessel maturation in vivo.
      was largely abrogated by PIEZO1 knockdown and ectopic overexpression of PIEZO1 upregulated FOXC2 and GATA2 expression by three- to fourfold, in the absence of oscillatory shear stress. Of note, FOXC2 was the first gene in which variations were strongly associated with primary venous valve failure in both the superficial and deep veins in the lower limb.
      • Ng MYM
      • Andrew T
      • Spector TD
      • Jeffrey S
      Lymphoedema Consortium
      Linkage to the FOXC2 region of chromosome 16 for varicose veins in otherwise healthy, unselected sibling pairs.
      These data demonstrate cross-talk between the signal pathways involving the key mechanosensor PIEZO1 and with FOXC2 upstream.
      • Choi D
      • Park E
      • Jung E
      • et al.
      Piezo1 incorporates mechanical force signals into the genetic program that governs lymphatic valve development and maintenance.
      Both FOXC2 and PIEZO1 are located on chromosome 16q34; however, they are separated by 2Mb.
      Our study further supports a positive feedback between the mechanotransduction mechanism of lymphatic valve formation and lymphatic fluid flow, that is, oscillatory shear stress created by lymphatic flow is essential for formation and maintenance of lymphatic valves, while proper lymphatic valves ensure lymphatic flow. Central lymphatic obstruction as documented in family members V-4 and VI-6 (Fig. 3E and F) interferes with lymphatic flow and would be expected to interfere with valve formation and function.
      • Witte MH
      Lymphangioleiomyomatosis and Gorham-Stout disease: primary or secondary disorders of the lymphatic system?.
      PIEZO1 and its cognate PIEZO2 have been involved in a number of diseases.
      • Alper SL
      Genetic diseases of PIEZO1 and PIEZO2 dysfunction.
      Originally, PIEZO1 was found to be mutated in dehydrated hereditary stomatocytosis (also known as xerocytosis because of the “shrunken” appearance of the red blood cells).
      • Zarychanski R
      • Schulz VP
      • Houston BL
      • et al.
      Mutations in the mechanotransduction protein PIEZO1 are associated with hereditary xerocytosis.
      ,
      • Albuisson J
      • Murthy SE
      • Bandell M
      • et al.
      Dehydrated hereditary stomatocytosis linked to gain-of-function mutations in mechanically activated PIEZO1 ion channels.
      It was soon realized that these were gain-of-function mutations.
      • Albuisson J
      • Murthy SE
      • Bandell M
      • et al.
      Dehydrated hereditary stomatocytosis linked to gain-of-function mutations in mechanically activated PIEZO1 ion channels.
      An indication that PIEZO1 might be involved in lymphatic disorders was evident from a family and singletons with hereditary stomatocytosis, pseudohyperkalemia, and perinatal edema.
      • Grootenboer S
      • Schischmanoff PO
      • Cynober TR
      • et al.
      A genetic syndrome associating dehydrated hereditary stomatocytosis, pseudohyperkalaemia and perinatal oedema.
      Therefore, it was not surprising to find recessive mutations, both missense and nonsense, in PIEZO1 associated with lower limb, and frequently upper limb and facial edema, with onset from birth (sometimes with nonimmune hydrops fetalis) to the end of the first decade.
      • Lukacs V
      • Mathur J
      • Mao R
      • et al.
      Impaired PIEZO1 function in patients with a novel autosomal recessive congenital lymphatic dysplasia.
      ,
      • Fotiou E
      • Martin-Almedina S
      • Simpson MA
      • et al.
      Novel mutations in PIEZO1 cause an autosomal recessive generalized lymphatic dysplasia with non-immune hydrops fetalis.
      Importantly, 3 recent studies have identified PIEZO1 gene mutations in patients suffering from persistent lymphedema, pleural effusions, and ascites associated with congenital lymphatic dysplasia, that is, primary lymphedema. Specifically, these studies identified homozygous and compound heterozygous PIEZO1 mutations in these patients.
      • Lukacs V
      • Mathur J
      • Mao R
      • et al.
      Impaired PIEZO1 function in patients with a novel autosomal recessive congenital lymphatic dysplasia.
      • Fotiou E
      • Martin-Almedina S
      • Simpson MA
      • et al.
      Novel mutations in PIEZO1 cause an autosomal recessive generalized lymphatic dysplasia with non-immune hydrops fetalis.
      • Datkhaeva I
      • Arboleda VA
      • Senaratne TN
      • et al.
      Identification of novel PIEZO1 variants using prenatal exome sequencing and correlation to ultrasound and autopsy findings of recurrent hydrops fetalis.
      Red blood cell abnormalities are occasionally found and are typically mild.
      • Fotiou E
      • Martin-Almedina S
      • Simpson MA
      • et al.
      Novel mutations in PIEZO1 cause an autosomal recessive generalized lymphatic dysplasia with non-immune hydrops fetalis.
      ,
      • Andolfo I
      • De Rosa G
      • Errichiello E
      • et al.
      PIEZO1 hypomorphic variants in congenital lymphatic dysplasia cause shape and hydration alterations of red blood cells.
      In our family, there were possible red blood cell abnormalities in PIEZO1 compound heterozygotes and homozygotes. An increase in red cell diameter was noted in 4/4 with available records, and associated with hematuria and documented intermittent jaundice in 2/2 who were studied. Hematuria or jaundice occurred only in individuals (Table) who were compound heterozygous or homozygous for PIEZO1 or mutations, and not in any non-lymphedema subjects.
      Dominant mutations in FOXC2 are associated with the lymphedema-distichiasis syndrome of usually teenage-onset lower-limb lymphedema and a double row of eyelashes.
      • Fang JM
      • Dagenais SL
      • Erickson RP
      • et al.
      Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome.
      These are mostly haploinsufficient mutations,
      • Erickson RP
      • Dagenais SL
      • Caulder MS
      • et al.
      Clinical heterogeneity in lymphedema-distichiasis with FOXC2 truncating mutations.
      but as mentioned above, overexpression mutants have also been found.
      • Tavian D
      • Missaglia S
      • Maltese PE
      • et al.
      FOXC2 disease-mutations identified in lymphedema-distichiasis patients cause both loss and gain of protein function.
      FOXC2 plays a major role in the development of venous valves. A large part of the genetic liability for the development of venous varicosities is linked to FOXC2, strongly implicating its gene product in the development of venous valves as well.
      • Geng X
      • Cha B
      • Mahamud MR
      • et al.
      Multiple models of primary lymphedema exhibit distinct defects in lymphovenous valve development.
      ,
      • Ng MYM
      • Andrew T
      • Spector TD
      • Jeffrey S
      Lymphoedema Consortium
      Linkage to the FOXC2 region of chromosome 16 for varicose veins in otherwise healthy, unselected sibling pairs.
      We did not see distichiasis in this family, but it can be mild and might have been missed. FOXC2 is the master transcription factor upstream in the signaling pathway for several important genes expressed in lymphatic endothelial cells involved in mechanotransduction and lymphatic valve development,
      • Geng X
      • Cha B
      • Mahamud MR
      • et al.
      Multiple models of primary lymphedema exhibit distinct defects in lymphovenous valve development.
      likely now also involving PIEZO1 as well as other human lymphedema genes, including CX37 (encoding connexin 37) and CELSR1. The lymphatic (lymphangioscintigraphic) phenotypes for both human FOXC2- and PIEZO1-related lymphedema exhibit similar hyperplasia, refluxing valves (incompetency), occasionally with central lymphatic dysplasias and accompanying venous valve insufficiency in contrast to the more common hypoplastic lymphatic, growth-inhibited form seen in typical Milroy syndrome related to VEGFC/VEGFR3 signaling pathway defects.
      • Kinmonth J
      Primary lymphoedema.
      ,
      • Sarica M
      • Gordon K
      • van Zanten M
      • et al.
      Lymphoscintigraphic abnormalities associated with Milroy disease and lymphedema-distichiasis syndrome.
      Our studies in this family demonstrate the importance of serial lymphatic phenotyping by combining different imaging modalities and monitoring changes with progression and regression of lymphedema in various body parts. For instance (Fig. 3), patient V-4 in the more recent lymphangioscintigram appeared to have hypoplastic lymphatic vessel(s) with absent tracer transport in the lower limbs (characteristic of Milroy disease from VEGFR3 mutations), but earlier findings showed the typical hyperplastic refluxing lymphatic phenotype associated with this genotype. In addition, the lymphatics of his upper limbs remained hyperplastic and suggested more proximal obstruction to lymph flow. Indeed, we detected the presence of previously unsuspected central lymphatic abnormalities using magnetic resonance imaging without contrast to image the thorax. This new modality provides a significant advance for non-invasive studies of central lymphatic abnormalities,
      • Seckeler MD
      • Moedano L
      • Mustacich D
      • et al.
      Non-contrast MR lymphography of rare lymphatic abnormalities.
      particularly relevant to defining the origin of the valve-incompetent refluxing lymphatic phenotype and offering treatment options.
      In summary, our family's members with only PIEZO1 mutations generally show moderate lymphedema, as previously reported.
      • Van Steensil MAM
      • Damstra RJ
      • Heitnk MV
      • et al.
      Novel missense mutations in the FOXC2 gene alter transcriptional activity.
      ,
      • Andolfo I
      • De Rosa G
      • Errichiello E
      • et al.
      PIEZO1 hypomorphic variants in congenital lymphatic dysplasia cause shape and hydration alterations of red blood cells.
      However, VI-6 exhibited fetal hydrops and extensive central lymphatic dysplasia with generalized retrograde reflux. The addition of a FOXC2 mutation tends to cause a more severe clinical phenotype. Thus, it may be seen as a modifying gene in this context. Lymphatic development provides an example where modifying genes greatly affect phenotype, including sex-limited penetrance occurring with some CELSR1 mutations.
      • Erickson RP
      • Lai LW
      • Mustacich DJ
      • Bernas MJ
      • Kuo PH
      • Witte MH
      Sex-limited penetrance of lymphedema to females with CELSR1 haploinsufficiency: a second family.
      Another example is a family where the phenotype of a FOXC2 mutation changed from teenage onset to fatal fetal hydrops with the change in the paternal contribution,
      • Sargent C
      • Bauer J
      • Khalil M
      • et al.
      A five generation family with a novel mutation in FOXC2 and lymphedema worsening to hydrops in the youngest generation.
      although we have not been able to identify the likely modifying gene(s) by sequencing.
      • Lai LW
      • Erickson RP
      • Bernas M
      • Witte MH
      From childhood onset lymphedema to fatal fetal hydrops: possible modifying genes for a FOXC2 mutation.

      Acknowledgments

      We thank Family 4 members for their participation, and Grace Wagner and Juan Ruiz for their technical assistance in preparation of the manuscript.

      References

        • Witte MH
        • Erickson R
        • Bernas M
        • et al.
        Phenotypic and genotypic heterogeneity in familial Milroy lymphedema.
        Lymphology. 1998; 31: 145-155
        • Holberg CJ
        • Erickson RP
        • Bernas MJ
        • et al.
        Segregation analyses and a genome-wide linkage search confirm genetic heterogeneity and suggest oligogenic inheritance in some Milroy congenital primary lymphedema families.
        Am J Med Genet. 2000; 98: 303-312
        • Erickson RP
        • Lai LW
        • Mustacich DJ
        • Bernas MJ
        • Kuo PH
        • Witte MH
        Sex-limited penetrance of lymphedema to females with CELSR1 haploinsufficiency: a second family.
        Clin Genet. 2019; 96: 478-482
        • Lai LW
        • Erickson RP
        • Bernas M
        • Witte MH
        From childhood onset lymphedema to fatal fetal hydrops: possible modifying genes for a FOXC2 mutation.
        Lymphology. 2018; 51: 85-88
        • Seckeler MD
        • Moedano L
        • Mustacich D
        • et al.
        Non-contrast MR lymphography of rare lymphatic abnormalities.
        Lymphology. 2020; 53: 133-137
        • Van Steensil MAM
        • Damstra RJ
        • Heitnk MV
        • et al.
        Novel missense mutations in the FOXC2 gene alter transcriptional activity.
        Hum Mutat. 2009; 30: E1002-E1009
        • Kinmonth J
        Primary lymphoedema.
        The Lymphatics: Diseases, Lymphography, and Surgery. Edward Arnold, London1972: 114-142
        • Sarica M
        • Gordon K
        • van Zanten M
        • et al.
        Lymphoscintigraphic abnormalities associated with Milroy disease and lymphedema-distichiasis syndrome.
        Lymphat Res Biol. 2019; 17: 610-619
        • Witte MH
        Lymphangioleiomyomatosis and Gorham-Stout disease: primary or secondary disorders of the lymphatic system?.
        Lymphology. 2017; 50: 114-119
        • Arias IM
        • Gartner LM
        • Cohen M
        • Ben-Ezzer J
        • Levi AJ
        Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronyl transferase deficiency: clinical, biochemical, pharmacologic and genetic evidence for heterogeneity.
        Am J Med. 1969; 47: 395-409
        • Greenlee R
        • Hoyme H
        • Witte M
        • Crowe CP
        • Witte C
        Developmental disorders of the lymphatic system.
        Lymphology. 1993; 26: 156-168
        • Karkkainen MJ
        • Ferrell RE
        • Lawrence EC
        • et al.
        Missense mutations interfere with VEGFR-3 signalling in primary lymphoedema.
        Nat Genet. 2000; 25: 153-159
        • Fang JM
        • Dagenais SL
        • Erickson RP
        • et al.
        Mutations in FOXC2 (MFH-1), a forkhead family transcription factor, are responsible for the hereditary lymphedema-distichiasis syndrome.
        Am J Hum Genet. 2000; 67: 1382-1388
        • Topf A
        • Griffin HR
        • Glen E
        • et al.
        Functionally significant, rare transcription factor variants in tetralogy of Fallot.
        PLoS One. 2014; 9: e95453
        • Noon A
        • Hunter RJ
        • Witte MH
        • et al.
        Comparative lymphatic, ocular, and metabolic phenotypes of FOXC2 haploinsufficient and AP2-FOXC2 Transgenic mice.
        Lymphology. 2006; 39: 84-94
        • Tavian D
        • Missaglia S
        • Maltese PE
        • et al.
        FOXC2 disease-mutations identified in lymphedema-distichiasis patients cause both loss and gain of protein function.
        Oncotarget. 2016; 7: 54228-54239
        • Witte MH
        • Erickson RP
        • Khalil M
        • et al.
        Lymphedema-distichiasis syndrome without FOXC2 mutation: evidence for Chromosome 16 duplication upstream of FOXC2.
        Lymphology. 2009; 42: 152-160
        • Ge J
        • Li W
        • Zhao Q
        • et al.
        Architecture of the mammalian mechanosensitive Piezo1 channel.
        Nature. 2015; 527: 64-69
        • Geng X
        • Cha B
        • Mahamud MR
        • et al.
        Multiple models of primary lymphedema exhibit distinct defects in lymphovenous valve development.
        Dev Biol. 2016; 409: 218-233
        • Choi D
        • Park E
        • Jung E
        • et al.
        Piezo1 incorporates mechanical force signals into the genetic program that governs lymphatic valve development and maintenance.
        JCI Insight. 2019; 4e125068
        • Nonomura K
        • Lukacs V
        • Sweet DTM
        • et al.
        Mechanically activated ion channel PIEZO1 is required for lymphatic valve formation.
        Proc Natl Acad Sci U S A. 2018; 115: 12817-12822
        • Sweet DT
        • Jiménez JM
        • Chang J
        • et al.
        Lymph flow regulates collecting lymphatic vessel maturation in vivo.
        J Clin Invest. 2015; 125: 2995-3007
        • Ng MYM
        • Andrew T
        • Spector TD
        • Jeffrey S
        • Lymphoedema Consortium
        Linkage to the FOXC2 region of chromosome 16 for varicose veins in otherwise healthy, unselected sibling pairs.
        J Med Genet. 2005; 42: 235-239
        • Alper SL
        Genetic diseases of PIEZO1 and PIEZO2 dysfunction.
        Curr Top Membr. 2017; 79: 97-134
        • Zarychanski R
        • Schulz VP
        • Houston BL
        • et al.
        Mutations in the mechanotransduction protein PIEZO1 are associated with hereditary xerocytosis.
        Blood. 2012; 120: 1908-1915
        • Albuisson J
        • Murthy SE
        • Bandell M
        • et al.
        Dehydrated hereditary stomatocytosis linked to gain-of-function mutations in mechanically activated PIEZO1 ion channels.
        Nat Commun. 2013; 4: 1884
        • Grootenboer S
        • Schischmanoff PO
        • Cynober TR
        • et al.
        A genetic syndrome associating dehydrated hereditary stomatocytosis, pseudohyperkalaemia and perinatal oedema.
        Br J Haemat. 1988; 103: 383-386
        • Lukacs V
        • Mathur J
        • Mao R
        • et al.
        Impaired PIEZO1 function in patients with a novel autosomal recessive congenital lymphatic dysplasia.
        Nat Commun. 2015; 6: 8329
        • Fotiou E
        • Martin-Almedina S
        • Simpson MA
        • et al.
        Novel mutations in PIEZO1 cause an autosomal recessive generalized lymphatic dysplasia with non-immune hydrops fetalis.
        Nat Commun. 2015; 6: 8085
        • Datkhaeva I
        • Arboleda VA
        • Senaratne TN
        • et al.
        Identification of novel PIEZO1 variants using prenatal exome sequencing and correlation to ultrasound and autopsy findings of recurrent hydrops fetalis.
        Am J Med Genet A. 2018; 176: 2829-2834
        • Andolfo I
        • De Rosa G
        • Errichiello E
        • et al.
        PIEZO1 hypomorphic variants in congenital lymphatic dysplasia cause shape and hydration alterations of red blood cells.
        Front Physiol. 2019; 10: 258
        • Erickson RP
        • Dagenais SL
        • Caulder MS
        • et al.
        Clinical heterogeneity in lymphedema-distichiasis with FOXC2 truncating mutations.
        J Med Genet. 2001; 38: 761-766
        • Sargent C
        • Bauer J
        • Khalil M
        • et al.
        A five generation family with a novel mutation in FOXC2 and lymphedema worsening to hydrops in the youngest generation.
        Am J Med Genet A. 2014; 164A: 2802-2807